• Language
  • Transcriptome Sequencing
  • Eukaryote
  • mRNA Sequencing
  • Non-coding RNA Sequencing
  • Long non-coding RNA Sequencing
  • Small RNA Sequencing
  • Circular RNA Sequencing
  • Whole Transcriptome Sequencing
  • Isoform Sequencing (Full-length Transcript Sequencing)
  • Prokaryote
  • Prokaryotic RNA Sequencing
  • Metatranscriptome Sequencing
  • Epigenomics
  • Whole Genome Bisulfite Sequencing (Gene Methylation)
  • Reduced Representation Bisulfite Sequencing (RRBS-Gene Methylation)
  • ChIP-Seq
  • RIP-Seq
  • Metagenomics
  • 16S/18S/ITS Amplicon Metagenomic Sequencing
  • Shotgun Metagenomic Sequencing
  • Pre-made Library Sequencing
  • Pre-made Library Sequencing
  • Clinical Diagnostics
  • Clinical Whole Exome Sequencing (CLIA/CAP)
  • Clinical Panels
  • Genetic Testing
  • Oncology
  • NovoPM™ 2.0
  • NovoFocus™ NSCLC 2.0
  • NovoFocus™ CRC 2.0
  • NovoFocus™ PARPi CDx 1.0
  • NovoFocus™ CR
  • Cancer Immunotherapy Biomarkers
  • Patient's Case Study
  • Biopharma Services
  • Discovery and Pre Clinical
  • Whole Genome Sequencing
  • Whole Exome Sequencing
  • RNA-Seq
  • FFPE RNA-seq
  • Small RNA Sequencing
  • Pacbio Sequencing (DNA)
  • Pacbio Sequencing (RNA)
  • Pre-made Library Sequencing
  • Translational and Clinical
  • NovoPM™ 2.0
  • NovoNeoantigen™ 2.0
  • Star Allele Analysis
  • Tumor Microenvironment Analysis
  • Companion Diagnostics
  • Service Support
  • Service Workflow
  • Sample Preparation Guide
  • Sample Requirements
  • Quality Management
  • Data Analysis
  • FAQs​​
  • Technology
  • Overview
  • Platform
  • Certification
  • Intelligent Delivery Platform
  • Resources
  • Publications
  • Downloads
  • Webinars
  • About
  • About Us
  • Major Milestones
  • Careers
  • News & Events
  • Partnership
  • Contact Us
  • De novo Sequencing
  • Animal & Plant De novo Sequencing
  • Microbial De novo Sequencing
  • Transcriptome Sequencing

  • Whole Transcriptome Sequencing
  • Isoform Sequencing (Full-length Transcript Sequencing)
  • Prokaryote
  • Prokaryotic RNA Sequencing
  • Metatranscriptome Sequencing
  • Epigenomics

    Metagenomics

    Pre-made Library Sequencing

  • Overview
  • Platform
  • Certification
  • Intelligent Delivery Platform
  • Publications
  • Downloads
  • Webinars
  • About Us
  • Major Milestones
  • Careers
  • News & Events
  • Partnership
  • Tell us about your project
    Contact us to discuss how we can help you achieve your research goals
    Services

    16S/18S/ITS Amplicon Metagenomic Sequencing

    Overview

    16S/18S/ITS amplicon metagenomic sequencing is frequently used to identify and differentiate microbial species. Short (<500 bp) hypervariable regions of conserved genes or intergenic regions, such as 16S of bacteria and archaea or 18S/ITS of fungi, are amplified by PCR and analyzed using next generation sequencing (NGS) technology. The resulting sequences are compared against microbial databases. Applications range from identifying a single species in pure culture and characterizing the microbiota of animals or plants, to comparing species diversity and population structure from various environmental sources or geographic regions. Our specialists can advise you on the appropriate analysis for your project.

    Service Specifications

    Applications

  • Species identification
  • Gut microbial environment research
  • Microbiota diversity
  • Difference of species composition
  • Advantages

  • Highly experienced: We have sequenced hundreds of thousands of samples, resulting in nearly 30 published articles.
  • Outstanding service: We provide high-quality sequencing (with Q30 score ≥ 75%), an efficient standard workflow, fast turnaround time, and cost-effective bioinformatics analysis.
  • Effective methodology: Our method features high amplification efficiency of sample DNA (> 95%).
  • Comprehensive analysis: We provide expert bioinformatics analysis using the latest sequence databases and software, generating high-quality, publication-ready data.
  • Sample Requirements


    table.table.text-center tbody tr td{ overflow-wrap: break-word;}

    Sample Type
    Amount
    Volume
    Purity
    Genomic DNA
    ≥ 200ng
    ≥ 12μL
    OD260/280=1.8-2.0

    Primer List of Amplicons

    Types
    Region
    Fragment Length
    Primer
    Primer sequences(5’- 3’)
    Bacterial 16S
    V4
    300 bp
    515F
    GTGCCAGCMGCCGCGGTAA
    806R
    GGACTACHVGGGTWTCTAAT
    V3-V4
    470 bp
    341F
    CCTAYGGGRBGCASCAG
    806R
    GGACTACNNGGGTATCTAAT
    V4-V5
    450 bp
    515F
    GTGCCAGCMGCCGCGGTAA
    907R
    CCGTCAATTCCTTTGAGTTT
    V5-V7 (for endophytic)
    300-400 bp
    799F
    AACMGGATTAGATACCCKG
    1193R
    ACGTCATCCCCACCTTCC
    Archaeal 16S
    V4-V5
    400-500 bp
    Arch519F
    CAGCCGCCGCGGTAA
    Arch915R
    GTGCTCCCCCGCCAATTCCT
    Archaeal 1106F
    V8
    300bp
    1106F
    TTWAGTCAGGCAACGAGC
    1378R
    TGTGCAAGGAGCAGGGAC
    Fungal 18S
    V4
    350 bp
    528F
    GCGGTAATTCCAGCTCCAA
    706R
    AATCCRAGAATTTCACCTCT
    V9
    200 bp
    1380F
    CCCTGCCHTTTGTACACAC
    1510R
    CCTTCYGCAGGTTCACCTAC
    Fungal ITS*
    ITS1
    200-400 bp
    ITS5-1737F
    GGAAGTAAAAGTCGTAACAAGG
    ITS2-2043R
    GCTGCGTTCTTCATCGATGC
    ITS2
    380 bp
    ITS3-2024F
    GCATCGATGAAGAACGCAGC
    ITS4-2409R
    TCCTCCGCTTATTGATATGC
    ITS1-1F (for endophytic)
    200-400 bp
    ITS1-1F-F
    CTTGGTCATTTAGAGGAAGTAA
    ITS1-1F-R
    GCTGCGTTCTTCATCGATGC

    Sequencing Parameter and Analysis Contents

    Platform Type
    Illumina NovaSeq 6000
    Read Length
    Paired-end 250 bp
    Recommended Sequencing Depth
    30K/50K/100K raw reads
    Standard Data Analysis
  • Data quality control
  • OTUs cluster and phylogenetic relationship construction
  • Species annotation
  • Alpha diversity analysis
  • Beta diversity analysis
  • Ternaryplot
  • NMDS analysis
  • LefSE analysis
  • Metastats analysis
  • Species T-test analysis
  • MRPP, Anosim, Adonis, Amova analysis
  • Comparative analysis of alpha diversity indices
  • Comparative analysis of beta diversity indices
  • Note: For detailed information, please refer to the Service Specifications and contact us for customized requests.

    Project Workflow

    Gut-dependent microbial translocation induces inflammation and cardiovascular events after ST-elevation myocardial infarction

    Background:

    Post-infarction cardiovascular remodeling and heart failure are the leading cause of myocardial infarction (MI)-driven death for the past decades. Experimental observations have involved intestinal microbiota in the susceptibility to MI in mice; however, in humans, identifying whether translocation of gut bacteria to systemic circulation contributes to cardiovascular events post-MI remains a major challenge.

    Sampling

    DNA from 49 healthy people, DNA from 50 people who has stable coronary artery disease (CHD) and 100 people who has ST segment elevation myocardial infarction (STEMI).

    Sequencing Strategy:

    Illumina platform, paired-end 250 bp

    Conclusions:
  • Intestinal-associated bacteria is enriched in systemic circulation. Because of the highest translocation products of intestinal bacteria in STEMI patients.
  • Intestinal bacterial translocation products are associated with inflammation and left ventricular function.
  • Intestinal flora translocation promotes cardiovascular events after STEMI.

  • Plant growth and oil contamination alter the diversity and composition of bacterial communities in agricultural soils across China

    Background:

    The dynamics of microbial diversity in response to biotic and abiotic disturbances provide a sensitive indicator for evaluating the potential stability and degradation of soils in agro‐ecosystems. To determine the effect on soil bacterial communities of disturbances by plant growth (Robinia pseudoacacia) and oil contamination, we sequenced 16S rRNA genes using MiSeq technology. Abiotic and biotic disturbances, including treating the soils with sterile water, crude oil, and/or an invasive plant, altered the bacterial community structure in the soils, increased bacterial richness, and reduced bacterial dispersion.

    Sampling

    DNA extracted from twenty‐one soil samples collected from corn fields in 19 provinces of China.

    Sequencing Strategy

    Illumina platform, paired-end 250bp

    Conclusions:

    The microbial taxa exhibited differential responses to the plant growth and oil contamination, and the assembly of the core microbiome was changed. Moreover, the bacterial communities in the soils from warmer regions were more sensitive to the environmental changes.

    The chemodiversity of paddy soil dissolved organic matter correlates with microbial community at continental scales

    Background:

    Paddy soil dissolved organic matter (DOM) represents a major hotspot for soil biogeochemistry, yet we know little about its chemodiversity let alone the microbial community that shapes it. Here, we leveraged ultrahigh-resolution mass spectrometry, amplicon, and metagenomic sequencing to characterize the molecular distribution of DOM and the taxonomic and functional microbial diversity in paddy soils across China. We hypothesized that variances in microbial community significantly associate with changes in soil DOM molecular composition.

    Sampling

    DNA extracted from soil samples that were collected from 88 flooded paddy sites across four typical Chinese rice-growing regions in 2014 and 2015.

    Sequencing Strategy:

    Illumina platform, paired-end 250 bp

    Conclusions:

    Our study demonstrates the continental-scale distribution of DOM is significantly correlated with the taxonomic profile and metabolic potential of the rice paddy microbiome. Abiotic factors that have a distinct effect on community structure can also influence the chemodiversity of DOM and vice versa.


    Results of OTU cluster and annotation analysis


    Species abundance heatmap


    Venn diagrams


    Taxonomy tree for single sample


    Rarefaction curves & rank abundance curves by individual samples


    Beta-diversity heatmap


    Principal Component Analysis (PCA) based in OTUs



    More Research Services