• Language
  • Transcriptome Sequencing
  • Eukaryote
  • mRNA Sequencing
  • Non-coding RNA Sequencing
  • Long non-coding RNA Sequencing
  • Small RNA Sequencing
  • Circular RNA Sequencing
  • Whole Transcriptome Sequencing
  • Isoform Sequencing (Full-length Transcript Sequencing)
  • Prokaryote
  • Prokaryotic RNA Sequencing
  • Metatranscriptome Sequencing
  • Epigenomics
  • Whole Genome Bisulfite Sequencing (Gene Methylation)
  • Reduced Representation Bisulfite Sequencing (RRBS-Gene Methylation)
  • ChIP-Seq
  • RIP-Seq
  • Metagenomics
  • 16S/18S/ITS Amplicon Metagenomic Sequencing
  • Shotgun Metagenomic Sequencing
  • Pre-made Library Sequencing
  • Pre-made Library Sequencing
  • Clinical Diagnostics
  • Clinical Whole Exome Sequencing (CLIA/CAP)
  • Clinical Panels
  • Genetic Testing
  • Oncology
  • NovoPM™ 2.0
  • NovoFocus™ NSCLC 2.0
  • NovoFocus™ CRC 2.0
  • NovoFocus™ PARPi CDx 1.0
  • NovoFocus™ CR
  • Cancer Immunotherapy Biomarkers
  • Patient's Case Study
  • Biopharma Services
  • Discovery and Pre Clinical
  • Whole Genome Sequencing
  • Whole Exome Sequencing
  • RNA-Seq
  • FFPE RNA-seq
  • Small RNA Sequencing
  • Pacbio Sequencing (DNA)
  • Pacbio Sequencing (RNA)
  • Pre-made Library Sequencing
  • Translational and Clinical
  • NovoPM™ 2.0
  • NovoNeoantigen™ 2.0
  • Star Allele Analysis
  • Tumor Microenvironment Analysis
  • Companion Diagnostics
  • Service Support
  • Service Workflow
  • Sample Preparation Guide
  • Sample Requirements
  • Quality Management
  • Data Analysis
  • FAQs​​
  • Technology
  • Overview
  • Platform
  • Certification
  • Intelligent Delivery Platform
  • Resources
  • Publications
  • Downloads
  • Webinars
  • About
  • About Us
  • Major Milestones
  • Careers
  • News & Events
  • Partnership
  • Contact Us
  • De novo Sequencing
  • Animal & Plant De novo Sequencing
  • Microbial De novo Sequencing
  • Transcriptome Sequencing

  • Whole Transcriptome Sequencing
  • Isoform Sequencing (Full-length Transcript Sequencing)
  • Prokaryote
  • Prokaryotic RNA Sequencing
  • Metatranscriptome Sequencing
  • Epigenomics

    Metagenomics

    Pre-made Library Sequencing

  • Overview
  • Platform
  • Certification
  • Intelligent Delivery Platform
  • Publications
  • Downloads
  • Webinars
  • About Us
  • Major Milestones
  • Careers
  • News & Events
  • Partnership
  • Tell us about your project
    Contact us to discuss how we can help you achieve your research goals
    Services

    Prokaryotic RNA Sequencing

    Overview

    The prokaryotes are mostly single-celled organisms that, by definition, lack membrane-bound nuclei and other organelles, which means the processes of transcription, translation, and mRNA degradation can all occur simultaneously. Prokaryotic transcription often covers more than one gene and produces polycistronic mRNAs that specify more than one protein, which is a main difference compared with eukaryotic transcripts.

    Prokaryotic RNA sequencing hyphenate next generation sequencing (NGS) to reveal the presence and quantity of RNA at a given moment, by analyzing the changing cellular transcriptome. Novogene’s prokaryotic RNA sequencing, adopted stranded RNA library to enable a more accurate estimate of transcript expression, especially for both antisense RNA and other overlapping genes, compared with non-stranded RNA-seq. It specifically aims at prokaryotes with reference genomes, providing clients with cost-effective and considerate solutions for transcriptome profiling, gene structure analysis, and more.

    If you work on prokaryotes without reference genomes, we can also provide customized services to meet your research objectives. For details, please contact us for details.

    Service Specifications

    Applications

    Functional genomics research

  • TSS analysis
  • Promoter region analysis
  • 5′ UTR analysis
  • Operator analysis
  • RNA regulation mechanism research

  • sRNA identification
  • Antisense transcript identification
  • Comparative Transcriptome Research

    Advantages

  • Extensive experience with thousands of projects successfully completed and multiple articles published in journals of high Impact Factors.
  • Unsurpassed data quality with a guaranteed Q30 score ≥ 80% that exceeds Illumina’s official benchmarks.
  • We use industry standard software and mature in-house pipeline to detect differential expressions, to discover novel transcripts and to make functional annotations.
  • Easily visualize data analysis results with Novogene’s user-friendly in-house software.
  • Sample Requirements

     

    Library Type
    Sample Type
    Amount
    RNA Integrity Number
    (Agilent 2100)
    Purity
    (NanoDrop)
    Prokaryotic RNA Library
    Total RNA
    ≥ 3 μg
    ≥ 6.0, smooth base line
    OD260/280 = 1.8-2.2;
    OD260/230 ≥ 1.8;

    Sequencing Parameter and Analysis

    Platform Type
    Illumina Novaseq 6000
    Read Length
    Pair-end 150
    Recommended Sequencing Depth
    ≥ 2GB raw data / sample for the species with reference genome
    Standard Data Analysis
  • Data Quality Control
  • Novel Transcript Prediction
  • Gene expression quantification & Differential expressed genes profiling & Functional analysis
  • Operon Analysis
  • SNP and InDel
  • UTR Analysis
  • Antisense Transcript Prediction
  • sRNA Analysis
  • Note: For detailed information, please refer to the Service Specifications and contact us for customized requests.

    Project Workflow

    Competitive control of endoglucanase gene engXCA expression in the plant pathogen Xanthomonas campestris by the global transcriptional regulators HpaR1 and Clp

    Background:

    Transcriptional regulators are key players in pathways that allow bacteria to alter gene expression in response to environmental conditions. However, work to understand how such transcriptional regulatory networks interact in bacterial plant pathogens is limited.
    Xanthomonas campestris pv. campestris (Xcc), a model bacterium used to study the plant–pathogen interactions.

    Sampling:

    • Total RNA of single bacterial colonies
    • Sequencing Strategy
    • Library preparation: strand-specific RNA library
    • Sequencing: HiSeq 2000 platform

    Results:

    Table 1 HpaR1 is a global regulatory protein that affects the expression of a number of genes overlapping with the Clp protein.

    FunctionI

    category

    ORF number in strain 8004(AT33913)
    Gene name
    Predicted product
    Fold change

    (hpaR1-/wt)

    Putative HpaR1/Clp co-binding sites
    Cell envelope and cell structure
    XC_1459
    (XCC2658)
    phuR
    Outer membrane haemin recepton
    2.11
    Energy and carbon metabolism
    XC_0279
    (XCC0269)
    2,5-Diketo-d-gluconate reductase B
    -2.63
    XC_0281
    (XCC0271)
    mocA
    Oxidoreductase
    -2.80
    GTGTGCGGAACGCTGAATCCACACC
    XC_3683
    (XCC0549)
    atpE
    F0F1 ATP synthase subuni C
    -2.56
    Conclusion:

    The data generated here describe how two global transcriptional regulators, HpaR1 and Clp, co-regulate a subset of virulence genes in Xcc. The RNA-seq helps to revel the influence of HpaR1 on the global transcriptome of Xcc.

    Production of primary metabolites in Microcystis aeruginosa in regulation of nitrogen limitation

    Background:

    Sustainable biofuels have attracted much attention, and microalgae are considered as
    the promising alternative feedstocks for the biofuel production. Although many studies focused on the accumulation of carbohydrates and lipids in different microalgae, limited reports uncovered the regulating mechanism of N deficiency. To promote the development and utilization of Microcystis aeruginosa, a potential feedstock for biofuel production, This paper investigated the growth, photosynthetic abilities, and the content of carbohydrates, lipids as well as proteins in the cells under different N levels, and analyzed the transcriptome to uncover the response mechanism to N deficiency.

    Sampling:

    Microcystis aeruginosa cells
    • Sequencing Strategy
    • Library preparation: mRNA library
    • Sequencing: Illumina platform

    Results:

    Table 2 * Varied expression of genes relating to photosynthesis and metabolism of carbohydrates, N and lipids in response to N deficiency.

    Gene ID
    Description
    Normal-N readcount
    Non-N readcount
    Fold change Non-N vs. Normal-N
    Photosynthesis
    MAE_02680
    Precorrin-6y C5, methyltransferase
    121.3±10.7
    66.3±3.2
    -45.30%
    MAE_25690
    Precorrin-4 C11, methyltransferase
    34.7±10.3
    16.7±2.9
    -51.90%
    MAE_16230
    Light-independent protochlorophyllide reductase subunit L
    785.3±305.2
    296.7±85.6
    -62.20%
    MAE_61890
    Biliverdin reductase
    114.3±12.3
    60.3±3.8
    47.20%

    Only part of varied expression of genes are listed in this table. Please refer to the literature for more information.

    Conclusion:

    N deficiency reduced M. aeruginosa photosynthetic abilities by triggering the down-regulation of genes involving in Chl synthesis, antenna proteins, photosynthetic electron transfer chain, and carbon fixation, which affected the cell growth. The accumulated carbohydrates under N deficiency can be used to produce bioethanol, while the remainder lipids after carbohydrate extraction can also be extracted to produce biodiesel for sufficient usage.


    Error Rate Distribution

    The x-axis shows the base position along each sequencing read and the y-axis shows the base error rate.


    GC Content Distribution

    Horizontal axis for reads position, vertical axis for single base percentage. Different color for different base type.


    Composition of raw data


    Overview of Mapping Status


    Distributions of gene expression levels


    Volcano plot for differentially expressed genes


    Significantly Enriched GO Terms in DEGs

    More Research Services